Protocol 30727: Probe Assay - Hba<tm1(HBA)Tow> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:32279355+32279447 93bp GTTGCTGGGTAACGAAGCTC AGGCACTCCAGGGACATAGA

Mutant=  120 bp

Wild Type = 93 bp

Sequence

Wt Sequence:  gttgctgggtaacgaagctcagtatcccacagagcctcctagaattcTTaaaagcccactaaaggtttacctttctatgtccctggagtgcct

 

Mutant Sequence: gttgctgggtaacgaagctcagtatcccacagagcctcctagaattctGCAGATATCCATCACACTGGCGGCCGCTGTCGACTCTAGAGGATCTTCTGCCAGACCCCCAGGAAATGACTT

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35298 Fluorophore-1 CTT AAA AGC CCA CTA AAG GTT TAC C Quencher-1 WT Probe
35299 GTT GCT GGG TAA CGA AGC TC Common A
35300 AAG TCA TTT CCT GGG GGT CT Mutant Reverse A
35301 AGG CAC TCC AGG GAC ATA GA Wild type Reverse A
35302 Fluorophore-2 GAT ATC CAT CAC ACT GGC GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35299 0.40 uM
35300 0.40 uM
35301 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.