For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 026859
Protocol 31762: Standard PCR Assay - Edil3<Tg(Sox2-cre)1Amc>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 165 bp
Heterozygote = 165 bp and 207 bp
Wild type = 207 bp
>chr13:89451210+89451416 207bp CTTGTGTAGAGTGATGGCTTGA TAGTGCCCCATTTTTGAAGG
This assay may be capable of distinguishing hemi from hom. Transgene integration site is known to be on mouse Chr 13.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is not able to be used for transgene copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37581 | CTT GTG TAG AGT GAT GGC TTG A | Wild type Forward | A | mChr13 | ||
| 37582 | TAG TGC CCC ATT TTT GAA GG | Common | A | mChr13 | ||
| 37583 | CCA GTG CAG TGA AGC AAA TC | Transgene Forward | A | Sox2 |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 37581 | 0.50 uM |
| 37582 | 0.50 uM |
| 37583 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.