Protocol 37862: Probe Assay - Igs2<tm1(CAG-xstpx-cas9)Mmw> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  70 bp

Wild Type = 77 bp

chr11:3245216-3245292 77bp AGGAGGCAGTGAGAGCATGA AGCAAAACCTGGCTGTGG

Sequence

Wt Sequence: cagcttcagcctgaagagtaagtagttctctattggcagtttgacacatcctgcccttaccttactaccactgttggctcagcagacacccaggataagtgcactagtgttcctttcctgaccagtgggactgctttttccagATTCCtcttgaagctgaggaggcagtgagagcatgatggcatctaatgagcttggaagtaccagactgccctgatccacagccaggttttgctgaaaagtgaccagtttgtcctcctccagtagagtgggcagctgaagGATTATAatctactgtcaagacttggaggcccctgcagtcaaagtccaatagaatattatgaaatggagaatggcttattttaatctctatagtggaatt

 

Mutant Sequence: CAGCAGACACCCAGGATAAGTGCACTAGTGTTCCTTTCCTGACCAGTGGGACTGCTTTTTCCAGATTCCTCTTGAAGCTGAGGAGGCAGTGAGAGCATGATGGgcgcgccccttactaggcggccgcgaagttcctataccttttgaagaataggaacttcggaataggaacttcgtcgacaaaggatccgtcggcgaccctacgcccccaactgagagaactcaaaggttaccccagttggggcactactcccgaaaacgtcggcgaccctacgcccccaactgagagaactcaagggcacgccctggcacccgcaccgcggcttcgagaccgtgacctac

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
52350 AGG AGG CAG TGA GAG CAT GA Common A Igs2
52351 TCT TCA AAA GGT ATA GGA ACT TCG Mutant Reverse A Vector
52352 AGC AAA ACC TGG CTG TGG Wild type Reverse A Igs2
52353 Fluorophore-1 CGC CCC TTA CTA GGC GGC C Quencher-1 MUT Probe
52354 Fluorophore-2 AGC TTG GAA GTA CCA GAC TGC CC Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
52350 0.40 uM
52351 0.40 uM
52352 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
027632 B6.129-Igs2tm1(CAG-cas9*)Mmw/J
026816 B6;129-Igs2tm1(CAG-cas9*)Mmw/J
2 strains use this protocol