Protocol 21989: End Point Analysis Assay - Kit<W-41J>-EP
Version 2.0

Notes

Mut = A

WT= G

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

GAGGTCACAAGGTTTAAGGTCCTCGTCTATCGCTGTCTTCATTAGCTGCTTGAATTTGC
TGTGTTCCGTTCTAGGCACGACTGCCC(g/a)TGAAGTGGATGGCACCAGAGAGCATTTT
CAGCTGCGTGTACACATTTGAAAGTGATGTCTGGTCCTATGGGATTTTCCTCTGGGAG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
24704 AGG TCC TCG TCT ATC GCT GT Forward A
24705 AAA TGC TCT CTG GTG CCA TC Reverse A
24706 Fluorophore-1 ACT GCC CGT GAA GTG GAT Quencher-1 WT Probe
24707 Fluorophore-2 ACT GCC CAT GAA GTG GAT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
24704 0.40 uM
24705 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
000119 C57BL/6J-KitW-41J/J
026622 NOD.Cg-KitW-41J Tyr + Prkdcscid Il2rgtm1Wjl/ThomJ
026497 NOD.Cg-KitW-41J Prkdcscid Il2rgtm1Wjl/WaskJ
026014 NOD.Cg-Rag1tm1Mom KitW-41J Il2rgtm1Wjl/EavJ
4 strains use this protocol