For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 026512
Protocol 21155: Probe Assay - Trp53<tm1Brn> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 145 bp
Wild Type = 63 bp
Sequence
Wt Sequence:tccatggattgctgtattggaatcaaacagaaatctatgtcattcacagcagtaacctcctgggaatacttcaagagacggagaaagggcgactgactgtgccctccgtcctttttcgcaatcctttattCTGTTCGAAtcataatttgt
tttcctgagacagggtttctctgtgtagtcctggctgtcctgggactcccctctgtagaccaggctggcctccaactgtctctgcctcctatgtgctgggatcaaaggtgcctgccaccaccgcctggcttcttagagttgg
Mutant Sequence:GAGACGGAGAAAGGGCGACTGACTGTGCCCTCCGTCCTTTTTCGCAATCCTTTATTCTGTTCGAtaagcttgatatcgaattcataacttcgtataatgtatgctatacgaagttatctgcagcccg
ggggatctgatatcaTCGAATCATAATTTGTTTTCCTGAGACAGGGTTTCTCTGTGTAGTCCTGGCTGTCCTGGGACTCCCCTCTGTAGACCAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 31852 | CGT CCT TTT TCG CAA TCC T | Forward | A | |||
| 31853 | GAA ACC CTG TCT CAG GAA AAC | Reverse | A | |||
| 31854 | Fluorophore-1 | CAA TCC TTT ATT CTG TTC GAA TCA T | Quencher-1 | WT Probe | ||
| 31855 | Fluorophore-2 | TGC TAT ACG AAG TTA TCT GCA GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 31852 | 0.40 uM |
| 31853 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 026512 | B6(Cg)-Tg(TPO-cre/ERT2)1139Tyj/J |
| 032435 | B6.129-Krastm4Tyj Trp53tm1Brn/J |
| 037954 | B6.Cg-Gt(ROSA)26Sortm4(CAG-cas9*/GAG-POL,-mNeonGreen)Tyj Trp53tm1Brn/TyjJ |
| 033754 | STOCK Brca2tm1Brn Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033755 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 033756 | STOCK Gt(ROSA)26Sortm3(CAG-EYFP)Hze Trp53tm1Brn/Trp53tm3Tyj Nkx3-1tm4(cre/ERT2)Mms Ptentm1Hwu/AbshnJ |
| 032429 | STOCK Krastm4Tyj Trp53tm1Brn Tg(Pdx1-cre/Esr1*)#Dam/J |
| 7 strains use this protocol | |