For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 026263
Protocol 20482: Probe Assay - Foxn1<em1j>del1-Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mut= 90 bp
Wt= 91 bp
Sequence
Wt Sequence: ATCCCTATCAGAGGATTGCACCCCAGGCcAAcgCCGAAGGTCACCAGCCAC
Mutant Sequence: ATCCCTATCAGAGGATTGCACCCCAGGC(-)AAcgCCGAAGGTCACCAGCCAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 30546 | CTA CCT GGG CTC ACC TCA CT | Forward | A | |||
| 30547 | GTA GAT GGG CTT TGG GAA GA | Reverse | A | |||
| 30548 | Fluorophore-1 | CAG GCC AAC GCC GAA GGT | Quencher-1 | |||
| 30549 | Fluorophore-2 | CAG GCA ACG CCG AAG GTC | Quencher-2 |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 30546 | 0.40 uM |
| 30547 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.