Protocol 35106: Probe Assay - Rb1<tm2Brn> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  169 bp

Wild Type = 131 bp

>chr14:73212799-73212929 131bp GCTCCAGTACTTAAGATATGTGACACT TGTCCCCTAATCCCTGTAAGT

Sequence

Wt Sequence: AAAGAACTTCCACTACACGTGTAAATTCTGCTGCAAATACAGAGACACAAGCAGCCTCAGCCTTCCATACTCAGAAGCCATTGAAATCTACCTCCCTTGCCCTGTTTTACAAAAAAGgtcagtaaaagattcctctcaagagctcagactcaTGGactaggttaagttgtggctccagtacttaagatatgtgacactaagcatatcacttGATAtctctatgccttggtttctttgcttataaatgaaaaaaaaAAAtaatataccctacaataatattaacttacagggattaggggacaattaaatgcatataaaatgctttaaacaggggttaaaccgggCATtgatggcacacgcctttaatcccagcactcaggaggcagaggcaggtggatttctga

 

Mutant Sequence:AGCCATTGAAATCTACCTCCCTTGCCCTGTTTTACAAAAAAGgtcagtaaaagattcctctcaagagctcagactcaTGGactaggttaagttgtggctccagtacttaagatatgtgacactaagcatatcacttgatATAACTTCGTATAGCATACATTATACGAAGTTatatctctatgccttggtttctttgcttataaatgaaaaaaaaatgataataatataccctacaataatattaacttacagggattaggggacaattaaatgcatataaaatgctttaaacaggggttaaaccgggcattgatgg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
45278 Fluorophore-1 AGC ATA TCA CTT GAT ATC TCT ATG CC Quencher-1 WT Probe
45279 Fluorophore-2 ACG AAG TTA TAT CTC TAT GCC TTG GT Quencher-2 MUT Probe
45280 GCT CCA GTA CTT AAG ATA TGT GAC ACT Forward A
45281 TGT CCC CTA ATC CCT GTA AGT Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
45280 0.40 uM
45281 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
026229 STOCK Akap12tm1Ihg Rb1tm2Brn Tg(Pbsn-cre)4Prb/J
026228 STOCK Akap12tm1Ihg/J
026563 STOCK Rb1tm2Brn/J
026662 STOCK Tg(Pbsn-cre)4Prb/J
4 strains use this protocol