For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 026228
Protocol 35106: Probe Assay - Rb1<tm2Brn> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 169 bp
Wild Type = 131 bp
>chr14:73212799-73212929 131bp GCTCCAGTACTTAAGATATGTGACACT TGTCCCCTAATCCCTGTAAGT
Sequence
Wt Sequence: AAAGAACTTCCACTACACGTGTAAATTCTGCTGCAAATACAGAGACACAAGCAGCCTCAGCCTTCCATACTCAGAAGCCATTGAAATCTACCTCCCTTGCCCTGTTTTACAAAAAAGgtcagtaaaagattcctctcaagagctcagactcaTGGactaggttaagttgtggctccagtacttaagatatgtgacactaagcatatcacttGATAtctctatgccttggtttctttgcttataaatgaaaaaaaaAAAtaatataccctacaataatattaacttacagggattaggggacaattaaatgcatataaaatgctttaaacaggggttaaaccgggCATtgatggcacacgcctttaatcccagcactcaggaggcagaggcaggtggatttctga
Mutant Sequence:AGCCATTGAAATCTACCTCCCTTGCCCTGTTTTACAAAAAAGgtcagtaaaagattcctctcaagagctcagactcaTGGactaggttaagttgtggctccagtacttaagatatgtgacactaagcatatcacttgatATAACTTCGTATAGCATACATTATACGAAGTTatatctctatgccttggtttctttgcttataaatgaaaaaaaaatgataataatataccctacaataatattaacttacagggattaggggacaattaaatgcatataaaatgctttaaacaggggttaaaccgggcattgatgg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45278 | Fluorophore-1 | AGC ATA TCA CTT GAT ATC TCT ATG CC | Quencher-1 | WT Probe | ||
| 45279 | Fluorophore-2 | ACG AAG TTA TAT CTC TAT GCC TTG GT | Quencher-2 | MUT Probe | ||
| 45280 | GCT CCA GTA CTT AAG ATA TGT GAC ACT | Forward | A | |||
| 45281 | TGT CCC CTA ATC CCT GTA AGT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45280 | 0.40 uM |
| 45281 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.