Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 102 bp
Wild Type = 145 bp
Wt Sequence:gcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcagg
ggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttt
Mutant Sequence: TGTATCTTATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGACCTGCAGCCCAAGCTAGATCGAATTC
GGCCGGCCGCGATCGCCTAGGGATGCATgaattcgccaccatgtacccatacgatgttccagattacgctatgACCTTGCACAATAacagtacaacctcgcctttgtttccaaacatcagctcctcctggatacacagcccctcc
gatgcagggctgcccccgggaaccgtcactcatttcggcagctacaatgtttctcgagcagctggcaatttctcctctccagacggtaccaccg
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
21310 | Fluorophore-1 | TAA CCT GGT GTG TGG GCG TTG T | Quencher-1 | WT Probe | ||
32843 | TCG CCT AGG GAT GCA TGA | Mutant Forward | A | |||
32845 | Fluorophore-2 | TCG CCA CCA TGT ACC CAT ACG | Quencher-2 | MUT Probe | ||
32851 | GAC TGA TTG CCC GAG CTG | Mutant Reverse | A | |||
oIMR3621 | CGT GAT CTG CAA CTC CAG TC | Wild type Forward | A | |||
oIMR9021 | CCG AAA ATC TGT GGG AAG TC | Wild type Reverse | A |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
32843 | 0.40 uM |
32851 | 0.40 uM |
oIMR3621 | 0.40 uM |
oIMR9021 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |