Protocol 21615: Probe Assay - Gt(ROSA)26Sor<tm1(CAG-CHRM4*,-mCitrine)Ute> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  102 bp

Wild Type = 145 bp

Sequence

Wt Sequence:gcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcagg

ggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttt

 

Mutant Sequence: TGTATCTTATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTCCCTCGACCTGCAGCCCAAGCTAGATCGAATTC

GGCCGGCCGCGATCGCCTAGGGATGCATgaattcgccaccatgtacccatacgatgttccagattacgctatgACCTTGCACAATAacagtacaacctcgcctttgtttccaaacatcagctcctcctggatacacagcccctcc

gatgcagggctgcccccgggaaccgtcactcatttcggcagctacaatgtttctcgagcagctggcaatttctcctctccagacggtaccaccg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21310 Fluorophore-1 TAA CCT GGT GTG TGG GCG TTG T Quencher-1 WT Probe
32843 TCG CCT AGG GAT GCA TGA Mutant Forward A
32845 Fluorophore-2 TCG CCA CCA TGT ACC CAT ACG Quencher-2 MUT Probe
32851 GAC TGA TTG CCC GAG CTG Mutant Reverse A
oIMR3621 CGT GAT CTG CAA CTC CAG TC Wild type Forward A
oIMR9021 CCG AAA ATC TGT GGG AAG TC Wild type Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
32843 0.40 uM
32851 0.40 uM
oIMR3621 0.40 uM
oIMR9021 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.