Protocol 31910: Probe Assay - Wdr41<em1(IMPC)J>
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  88 bp

Wild Type = 148 bp.

>chr13:94978617+94978764 148bp CTGACAAAGACGATTTAGAGCA ACCATCAGGGTTCAAAGTCC

Sequence

Wt Sequence (deleted region in lower case, insertion in carrots)

TCATGAGGGTCCCCGGGACGGAGCTCAGGTCATCAGACTTAGTGACAAGTGCCTTTACCTGCTGAGCTAGCTCCTTGGTCCTAACAAACTTTGATTGAGAAACAACAGTTGAGTTGA^GTTGA^TTGGCCCAgtagttttaaaGTCGGGTTTATTGAGACTCAACAAAATAAAGTTTACTCTTTACAAGTTTATTGTGGTTTGAAAACACCAAAGGTTTTGATAAGAGAAATACTTCCATgtagaactggtatgtattagcattagaacataatatcttgtggcttctaaaagcttttgttcttgcatggatactgtgcagttaaaatcattttatgcttatgttttgtgttttgtgggtttttttttttttcattacaagaaagctgctttgcagacaataggagaggaccaaggtcagaacccctatactgaactgctggtactggaggctcatcgcgacattgtccgcttcctggtgaggctcgatgacttcaggtaagaggcttactctgcccagtggtcaatgctgacaaagacgatttagagcattttatgtttaaaacaacttcaaacttaaattatcttttgtaaaaactttCAGAATCCTGAAATATAACCAACTGAAAATTGTAGCATTTAATATTCAGTTGGAATGGACTTTGAACCCTGATGGTAACATGTTTAAATCCTTTGAAATCCATGTCACCTTGTCAGAGTCTGGTTGTCTTGACAATTACATTTGTTTGCTTTTTTTTTTCTTTGATGTTTTGGAAAAAATTGTCATGAGGTTTTAGAAATATTCTTACTACCTTAGAAGAAGCAAATGACTTTAAGATTGAGTTGTAGCTGTCAAATCTGAGAATCAAATATGTATGGAGTTTAATTTAATATTAGATACCCGCTA

391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels,  a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
37958 GGT TTG AAA ACA CCA AAG GTT Mutant Forward A
37959 ACC ATC AGG GTT CAA AGT CC Common A
37960 CTG ACA AAG ACG ATT TAG AGC A Wild type Forward A
37961 Fluorophore-1 AGA GAA ATA CTT CCA TGT AGC ATT TAA T Quencher-1 MUT Probe
37962 Fluorophore-2 CAG AAT CCT GAA ATA TAA CCA ACT GA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
37958 0.40 uM
37959 0.40 uM
37960 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.