Protocol 22042: End Point Analysis Assay - Otop3<m1J>-EP
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

GCATGACCCTGGAGCCTCGGGAGACGGAGGCAG(g/a)GAAACTGTTCCC

TGCAGAATCCCCTAGGACCA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
21146 GAG CAG AGG AAC TCC AGC AC Forward A
21147 AAG AGG GGA CAA AGG GAT TG Reverse A
21291 Fluorophore-1 CGG AGG CAG GGA AAC TGT T Quencher-1 WT Probe
21292 Fluorophore-2 ACG GAG GCA GAG AAA CTG TTC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
21146 0.40 uM
21147 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.