For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 025701
Protocol 31593: Probe Assay - Gt(ROSA)26Sor<tm1(Smo/EYFP)Amc> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 193 bp
>chr6:113025913-113026105 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC
Sequence
Wt Sequence:gcacttgctctcccaaagtcgctctgagttgttatcagtaagggagctgcagtggagtaggcggggagaaggccgcacccttctccggaggggggaggggagtgttgcaatacctttctgggagttctctgctgcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttttttaataggggcaaataaggaaaatgggaggataggtagtcatctggggttttatgcagcaaaactacaggttattattgcttgtgatccgcctcggagtattttccatcgaggtagattaaagacatgctcacccgagttttatactctcctgcttgagatccttactacagtatgaaatta
Mutant Sequence: TGGGCTCAGGGCCGCCTCCAGGGGCTGGGATCCATTCATTCCCGCACTAACCTAATGGAGGCTGAGcTCTTGGATGCAGACTCGGACTTCctcgagctcaagcttcgaattctgcagtcgacggtaccgcgggcccgggatccaccggtcgccaccATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21306 | CTG GCT TCT GAG GAC CG | Wild type Forward | A | |||
| 21309 | AAT CTG TGG GAA GTC TTG TCC | Wild type Reverse | A | |||
| 21310 | Fluorophore-1 | TAA CCT GGT GTG TGG GCG TTG T | Quencher-1 | WT Probe | ||
| 32856 | CTC CTC GCC CTT GCT CAC | Transgene Reverse | A | |||
| 37228 | CTT GGA TGC AGA CTC GGA CT | Transgene Forward | A | |||
| 37229 | Fluorophore-2 | CTC GAG CTC AAG CTT CGA ATT CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 21306 | 0.40 uM |
| 21309 | 0.40 uM |
| 32856 | 0.40 uM |
| 37228 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.