For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 025533
Protocol 35414: Standard PCR Assay - Tg(Thy1-SNCA)15Mjff-Chr 11
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Transgene = ~250 bp
Wt = 329 bp
>chr11:40463572-40463900 329bp GCATGATCCTGAGACGGACT TGCTCTGGGCTCCATTTC
This assay may be capable of distinguishing hemi from hom. Transgene insertion site is known to be on mouse Chr 11.
This assay is designed around this insertion site, but it has not been tested on hom animals.
This assay is NOT able to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27563 | CTT TCT CTG AGT GGC AAA GGA | Transgene Forward | A | Thy1 | ||
| 45999 | CCA CAC CCT GTT TGG TTT TC | Transgene Reverse | A | SNCA | ||
| 46000 | GCA TGA TCC TGA GAC GGA CT | Wild type Forward | A | |||
| 46001 | TGC TCT GGG CTC CAT TTC | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 27563 | 0.50 uM |
| 45999 | 0.50 uM |
| 46000 | 0.50 uM |
| 46001 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.