Stock No: 025474
Protocol 36609: End Point Analysis Assay - Fbn1<tm3.1Hcd> EP
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =C/C
Heterozygote = G/C
Wild type = G/G

>chr2:125345838-125345923 86bp CTTCCTGCTGTTGTTCACTGG GGAGGATGTCTACTTACATGTGTTCA

Sequence

GATACAGCCTGCAGCAATGAAATTGGAGTTGGTGTCTCTAAGGCTTCCTGCTGTTGTTCACTGGGTAAAGCTTGg/cGGAACCCCATGTGAGCTGTGTCCTTCTGTGAACACATgtaagtagacatcctccatcttactactactacaactactactacatatatctactgctctgtttcagtccagttct

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49211 Fluorophore-1 AAA GCT TGC GGA ACC CCA TGT Quencher-1 MUT Probe
49212 Fluorophore-2 AAA GCT TGG GGA ACC CCA TGT Quencher-2 WT Probe
49213 CTT CCT GCT GTT GTT CAC TGG Forward A
49214 GGA GGA TGT CTA CTT ACA TGT GTT CA Reverse A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49213 0.40 uM
49214 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.