For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 025418
Protocol 12250: Sanger sequencing Assay - Megf8<m687Ddg>
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Hom = C/C
HET = T/C
WT = T/T
Sequence
ccttctgcccctctagGTCTCTATGGTCATTCTGCAGTCTACCACGAGGCCACCGACTCCCTCTATGTGTTTGGGGGTTTCCGCTTCCACGTGGAGCTGGCAGCACCTTC
TCCGGAGCt/cCTACTCCCTGCACTGTCCTGACCGTACCTGGAGCCTGCTGGCACCTTCTCAGGGGGCAAAGgttaggacagctggctgtagccacggcagggggttccccaag
gactagctccactcacccagattcctgt
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 20416 | CCT TCT GCC CCT CTA GGT CT | Forward | ||||
| 20417 | ACA GGA ATC TGG GTG AGT GG | Reverse |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| High Fidelity Buffer | 1.00 |
| dNTP | 0.05 |
| MgSO4 | 1.00 |
| Platinum Taq Pol. | 0.02 |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 55.0 | -- | |
| 4 | 68.0 | -- | |
| 5 | -- | Go to step 2-4, 35 times | |
| 6 | 68.0 | -- | |
| 7 | 4.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.