Stock No: 025200
Protocol 21917: End Point Analysis Assay - Alb<em8Mvw>-EP
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = -
Heterozygote = C/-
Wild type = C

Sequence

TTCCAAACCTCCGTGAAAACTATGGTGAACTGGCTGACTGCTGTACAAAACAAGAGCCCGAAAGAAACGAATGTTTCCTGCAACACAAAGATGACAACc/-CCAGCCTGCCA

CCATTTGAAAGGCCAGAGGCTGAGGCCATGTGCACCTCCTTTAAGGAAAACCCAACCACCTTTATGGGACAgtgagtacccagacatctacactttatgctaaaaactgggcaatagctccgtt

agtaacacttatgctgatagtcatgaaaaccccaagcatccaacaccaagtctgggaat

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
25280 CAA AAC AAG AGC CCG AAA GA Forward A
25281 CTC TGG CCT TTC AAA TGG TG Reverse A
25282 Fluorophore-1 TGA CAA CCC CAG CCT GC Quencher-1 WT Probe
25284 Fluorophore-2 TGA CAA CCC AGC CTG CC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
25280 0.40 uM
25281 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.