Stock No: 024906
Protocol 21905: Separated QPCR Assay - Generic Puromycin-QPCR
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

ATGACCGAGTACAAGCCCACGGTGCGCCTCGCCACCCGCGACGACGTCCCCAGGGCCGTACGCACCCTCGCCGC
CGCGTTCGCCGACTACCCCGCCACGCGCCACACCGTCGATCCGGACCGCCACATCGAGCGGGTCACCGAGCTGC
AAGAACTCTTCCTCACGCGCGTCGGGCTCGACATCGGCAAGGTGTGGGTCGCGGACGACGGCGCCGCGGTGGCG
GTCTGGACCACGCCGGAGAGCGTCGAAGCGGGGGCGGTGTTCGCCGAGATCGGCCCGCGCATGGCCGAGTTGAG
CGGTTCCCGGCTGGCCGCGCAGCAACAGATGGAAGGCCTCCTGGCGCCGCACCGGCCCAAGGAGCCCGCGTGGT
TCCTGGCCACCGTCGGCGTCTCGCCCGACCACCAGGGCAAGGGTCTGGGCAGCGCCGTCGTGCTCCCCGGAGTG
GAGGCGGCCGAGCGCGCCGGGGTGCCCGCCTTCCTGGAGACCTCCGCGCCCCGCAACCTCCCCTTCTACGAGCG
GCTCGGCTTCACCGTCACCGCCGACGTCGAGGTGCCCGAAGGACCGCGCACCTGGTGCATGACCCGCAAGCCCG
GTGCCTGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13926 TGC AAG AAC TCT TCC TCA CG Forward B
13927 CGA TCT CGG CGA ACA CC Reverse B
13928 Fluorophore-1 ACA TCG GCA AGG TGT GGG TCG Quencher-1
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Primer 3 0.40 uM
Primer 4 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Reaction B

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
13926 0.40 uM
13927 0.40 uM
Primer 3 0.40 uM
Primer 4 0.40 uM
Tg Probe 0.15 uM
IC Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
024906 129-Dp(16Tiam1-Il10rb)8Yey/J
003208 STOCK Dnmt1tm3Jae Hprtb-m3 Tg(pPWL512hyg)1Ems/J
031010 STOCK Gt(ROSA)26Sortm1(rtTA,EGFP)Nagy TgTn(pb-tetO-Pou5f1,-Klf4,-Myc,-Sox2,-mCherry)250Nagy Tg(Pou5f1-EGFP)1Nagy/J
3 strains use this protocol