For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 024857
Protocol 32228: Probe Assay - Gt(ROSA)26Sor<#m1(Stop-Cas9)> Probe
Version 1.0
Notes
Mutant= 129 bp
Wild Type = 193 bp
>chr6:113025913-113026105 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC
Mutant= 129 bp
Wild Type = 193 bp
>chr6:113025913-113026105 193bp CTGGCTTCTGAGGACCG AATCTGTGGGAAGTCTTGTCC
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
Wt Sequence:atacctttctgggagttctctgctgcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgggaagttttttaatag
Mutant Sequence: ATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCCCCATCAAGCTGATCCGGAACCCTTAATATaacttcgtataatgtatgctatacgaagttattaggtccctcgacctgcagcccaagctagatcgaattcggccggccttcgaacacgtgccaccATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCCCAAAGAAGAAGCGGAAGGTCGGTAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 21306 | CTG GCT TCT GAG GAC CG | Wild type Forward | A | |||
| 21309 | AAT CTG TGG GAA GTC TTG TCC | Wild type Reverse | A | |||
| 21310 | Fluorophore-1 | TAA CCT GGT GTG TGG GCG TTG T | Quencher-1 | WT Probe | ||
| 37294 | TCC GGA ACC CTT AAT ATA ACT TCG | Mutant Forward | A | |||
| 38645 | Fluorophore-2 | TGG TCC TTA TAG TCC ATG GTG | Quencher-2 | Mutant Reverse | A | Cas9 |
| 38646 | Fluorophore-3 | AGG TCC CTC GAC CTG CAG C | Quencher-3 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 21306 | 0.40 uM |
| 21309 | 0.40 uM |
| 37294 | 0.40 uM |
| 38645 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.