Protocol 21966: End Point Analysis Assay - Golga3<repro27>
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Heterozygote = C/T
Wild type = C/C

Sequence

GCAGTTTTACAGCGCAAAGAGGAGGAGGATCGCCAGATG

AAGCAACTTGTCCAAGCCTTA(C/T)AAGTCTCACTAGAGAAAG

AAAAGATGGAAGTGAACAGCCTGAAGGAACAGg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
18756 TTA CAG CGC AAA GAG GAG GA Forward A
18757 CCT TCA GGC TGT TCA CTT CC Reverse A
18760 Fluorophore-1 GTC CAA GCC TTA CAA GTC TCA CTA G Quencher-1 WT Probe
18761 Fluorophore-2 TGT CCA AGC CTT ATA AGT CTC ACT AGA Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
18756 0.40 uM
18757 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
024382 C3Fe.B6-Golga3repro27/LincMmjax
024383 C57BL/6J(C3Fe)-Golga3repro27/LincMmjax
2 strains use this protocol