Stock No: 024342
Protocol 39492: Probe Assay - Rela<tm1Ukl>-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr19:5638040+5638170 131bp CCTTGACTCAGTGTCCCTCCT AGTCAGATACTTTCTTCCTTACACG

Mut= 140 bp

Wt= 131 bp

Fam=Mut

Hex=Wt

The Common primer (primer 53932) anneals over the nucleotide sequence containing mouse genomic variations rs238833930.

Sequence

Wt Sequence:

ggcggggcgggctgcgagggggtctgactcagttacccctctcagtggagggcgccttgactcagtgtccctcctgggtgggggtacgggtgaatcttgactccgtttcctccggctccccccacccccgtgtcgatgcgattagttctggcttcctttccgtgtaaggaagaaagtatctgactcagtttccccagaagaggagaggagggtattaccc

Mutant Sequence:

CCCAGCGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAGAATTCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCCTCGAGCGTGTCGATGCGATTAGTTCTGGCTTCCTTTCCGTGTAAGGAAGAAAGTATCTGACTCAGTTTCCCCAGAAGAGGAGAGGAGGGTATTACCCCCTCCTCAGTGTCACTTATGAACGTAAAACAGGCACTGACTCAGTTTCCCCTGGCAAAGGAATGCCTCTGTGTCCCCTTTCTCTAGTTCCCCGGCCTCTGTCAGGGCAGGTTTCAGGGTCTTGGCTCAGTTTTCTTGGAAGGGAGGGAGCTTGGCTCTGTCAGGCCTTCGCAGGTGAGGGTGGGCACTGGAGTTTATTGACAATGTGCCTTGTCTTTCCCTTTC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
46629 CAG ACT GCC TTG GGA AAA GC Mutant Forward A
53931 CCT TGA CTC AGT GTC CCT CCT Wild type Forward A
53932 AGT CAG ATA CTT TCT TCC TTA CAC G Common A
53933 Fluorophore-1 ACG GGT GAA TCT TGA CTC CG Quencher-1 WT Probe
53934 Fluorophore-2 CCT CCC CTA CCC GGT AGA ATT C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
46629 0.40 uM
53931 0.40 uM
53932 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
1 95.0 --
2 95.0 --
2 95.0 --
3 60.0 -- repeat steps 2-3 for 40 cycles
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.