Protocol 20781: Probe Assay - GCaMP6s-Probe
Version 1.0

Notes

This assay cannot distinguish hemi from hom

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Tg=  85 bp

IPC = 74 bp

This assay distinguishes GCaMP6s from GCaMP6f and GCaMP3

Sequence

aagacaggtcacgcagtcagagctataggtcggctgagctcactcgagaacgtctatatcaaggccgacaagcagaagaacggcatcaaggcgaacttc[CaC]atccgccacaacatcgaggacggcggcgtgcagctcgcctaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaacc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27656 TGG TAG TGG TAG GCG AGC TG Transgene Reverse A
31033 ACA AGC AGA AGA ACG GCA TC Transgene Forward A
31034 Fluorophore-1 CGA ACT TCC ACA TCC GCC Quencher-1 Tg Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
27656 0.40 uM
31033 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
024115 B6.Cg-Igs7tm94.1(tetO-GCaMP6s)Hze Tg(Camk2a-tTA)1Mmay/J
024104 B6.Cg-Igs7tm94.1(tetO-GCaMP6s)Hze/J
025776 C57BL/6J-Tg(Thy1-GCaMP6s)GP4.12Dkim/J
024275 C57BL/6J-Tg(Thy1-GCaMP6s)GP4.3Dkim/J
028278 C57BL/6J-Tg(Thy1-GCaMP6s)GP4.6Dkim/J
024112 STOCK Gt(ROSA)26Sortm5(ACTB-tTA)Luo Igs7tm94.1(tetO-GCaMP6s)Hze/J
6 strains use this protocol