Stock No: 023409
Protocol 40003: Probe Assay - Vps35<tm1.1Mjff> Probe Alternate2
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  88 bp

Wild Type = 85 bp

chr8:85263616-85263700 85bp GCTGTAGTTTGTGCCTCTTCAC TCCAAACCCCATTCTATGAGAT

Sequence

Wt Sequence: agttgagaagtattagctcaagaaagttggactagggttcttttggctgtagtttgtgcctcttcactgaaaggtacaccgtgcactAGTGTGAATGGCACTTGGaccatctcatagaatggggtttggaagaactttagaaagtgttcctattgatggttggttcatgaatattctttgttctatgtataccagGCATTTTCTCTATATGAAGATG

 

Mutant Sequence: AGCTCAAGAAAGTTGGACTAGGGTTCTTTTGGCTGTAgtttgtgcctcttcactgaaaggtacaccgtgcacttaattaagccaagcaggcataacttcgtatagcatacattatacgaagTTATTAGTGTGAATGGCACTTGGACCATCTCATAGAATGGGGTTTGGAAGAACTTTAGAAAGTGTTCCTATTGATGGTTGGTTCATGAATATTCTTTGTTCTATGTATACCAGGCATTTTCTCTATATGAAGATG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
53273 GCT GTA GTT TGT GCC TCT TCA C Wild type Forward A
53274 TCC AAA CCC CAT TCT ATG AGA T Wild type Reverse A
53278 Fluorophore-1 CCG TGC ACT AGT GTG AAT GGC Quencher-1 WT Probe
54103 CCA AGC AGG CAT AAC TTC GT Mutant Forward A
54104 TCC AAA CCC CAT TCT ATG AG Mutant Reverse A
55045 Fluorophore-2 TAT ACG AAG TTA TTA GTG TGA ATG GC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
53273 0.40 uM
53274 0.40 uM
54103 0.40 uM
54104 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.