Stock No: 023359
Protocol 39795: Probe Assay - Tet2<tm1.2Rao> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  100 bp

Wild Type = 98 bp

chr3:133471397-133471494 98bp ACACATCTGTCTGTCAGGTTGA CAAACATGCAGTGACTCCTGA

Sequence

Wt Sequence: ttgttcaacagtagcaatttgaaattagatggtgtcagagggaatttaggtcatgccactttagaagcctattggaaacatttctTTGTGAGCatgggatagtggggatgtaacagtatttccattttttaaacaaactgctcagcattgaatgtagttagtccagagaattttatccacacttaaaatgtccagt

 

Mutant Sequence: ATTGTTCAACAGTAGCAATTTGAAATTAGATGGTGTCAGAGGGAATTTAGGTCATGCCACTTTAGAAGCCTATTGGAAACATTTCTggatatcgcggccgcatAACTTCGTATAATGTATGCTATACGAAGTTATtaggtggatccgaagcttatcgataccgtcgacctcgacAATAACCCTTGCTGTATGTCTATAATTAGAGCTACTAAAAAGAAATCCAGTGTTTCCTTAAGCAGTCCTCTTTGCTCTGAGAGGTAAAAGTCCCCTCCTTGCTGGTTTCCATGATAACACTGTTCATTTCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
54641 AGG TCA TGC CAC TTT AGA AGC Mutant Forward A
54642 TCG GAT CCA CCT AAT AAC TTC G Wild type Reverse A
54643 ACA CAT CTG TCT GTC AGG TTG A Wild type Forward A
54645 CAA ACA TGC AGT GAC TCC TGA Wild type Reverse A
54646 Fluorophore-1 CTG GAT ATC GCG GCC GC Quencher-1 MUT Probe
54648 Fluorophore-2 CAC CAA GCC CCA GAC TGC TG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54641 0.40 uM
54642 0.40 uM
54643 0.40 uM
54645 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.