For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 87 bp
Wild Type = 113 bp
Wt Sequence:
Mutant Sequence: TCGTGCTGGTTATTGTGCTGTCTCATCATTTTGGCAAAGAATTGATTTGATACCGCGGGCCCGGGTTCGCCACCATGGTTGGTATCAAAGATCTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATAACTTCGTATAGTACACATT
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
34918 | TGT GCT GTC TCA TCA TTT TGG | Mutant Reverse | A | |||
36724 | CTT GAA GCT GAG GAG GCA GT | Wild type Forward | A | |||
36725 | GGA GGA GGA CAA ACT GGT CA | Wild type Reverse | A | |||
36726 | Fluorophore-1 | AGC ATG ATG GCA TCT AAT GAG CTT | Quencher-1 | WT Probe | ||
36731 | GAA CTT CGG AGA TCT TTG ATA CC | Mutant Reverse | A | |||
37040 | Fluorophore-2 | CGG GTT CGC CAC CAT GGT | Quencher-2 | MUT Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
34918 | 0.40 uM |
36724 | 0.40 uM |
36725 | 0.40 uM |
36731 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |