Protocol 31367: Probe Assay - Igs2<tm1(ACTB-EGFP,-tdTomato)Zng> GT Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  79 bp

Wild Type = 113 bp

>chr11:3145193-3145305 113bp CTTGAAGCTGAGGAGGCAGT GGAGGAGGACAAACTGGTCA

Sequence

Wt Sequence:tattggcagtttgacacatcctgcccttaccttactaccactgttggctcagcagacacccaggataagtgcactagtgttcctttcctgaccagtgggactgctttttccagattcctcttgaagctgaggaggcagtgagagcatgatgGCatctaatgagcttggaagtaccagactgccctgatccacagccaggttttgctgaaaagtgaccagtttgtcctcctccagtagagtgggcagctgaaggattataatctactgtcaagacttggaggcccctgcagtcaaagtccaatagaatattatgaaatggagaatggcttattttaatctctatagtggaattaaaatagca

 

Mutant Sequence: cctgggcaacgtgctggttattgtgctgtctcatcattttggcaaagaattgatttgataccgcgggcccGGGATCCGATATCCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAggttggtatcaaagatctccgaagttcctattctctagaaagtataggaacttcataacttcgtatagtacacattatac

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
36724 CTT GAA GCT GAG GAG GCA GT Wild type Forward A
36725 GGA GGA GGA CAA ACT GGT CA Wild type Reverse A
36726 Fluorophore-1 AGC ATG ATG GCA TCT AAT GAG CTT Quencher-1 WT Probe
36731 GAA CTT CGG AGA TCT TTG ATA CC Mutant Reverse A
36738 CTA CCC CGA CCA CAT GAA G Mutant Forward A
36739 Fluorophore-2 AGC ACG ACT TCT TCA AGT CCG C Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
36724 0.40 uM
36725 0.40 uM
36731 0.40 uM
36738 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.