Protocol 21934: End Point Analysis Assay - Crb1<rd8+em1Mvw>-Alternate 2
Version 4.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant =(t)TACAG(cag)TATCGGTGTG CCTGTCT(c)
Heterozygote = (c/t)TACAG(ttc/cag)TATCGGTGTG CCTGTCT(c/g)
Wild type = (c)TACAG(ttc)TATCGGTGTG CCTGTCT(g)

Sequence

GGAGGAAACTGTGAAGACAG(c/t)TACAG(ttc/cag)TATCGGTGTG

CCTGTCT(c/-)TCGGGATGGTCAGGGACACACTGTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
16217 TTG CAT GGA GGA AAC TGT GA Forward A
19251 CTG CAA CTC CAT CAG AGC AG Reverse A
19349 Fluorophore-1 GAA GAC AGC TAC AGT TCT TAT GGT G Quencher-1 WT Probe
21045 Fluorophore-2 AAG ACA GTT ACA GCA GTT ATC GGT GT Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
16217 0.40 uM
19251 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.