Stock No: 022521
Protocol 21934: End Point Analysis Assay - Crb1<rd8+em1Mvw>-Alternate 2
Version 4.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =(t)TACAG(cag)TATCGGTGTG CCTGTCT(c)
Heterozygote = (c/t)TACAG(ttc/cag)TATCGGTGTG CCTGTCT(c/g)
Wild type = (c)TACAG(ttc)TATCGGTGTG CCTGTCT(g)
Sequence
GGAGGAAACTGTGAAGACAG(c/t)TACAG(ttc/cag)TATCGGTGTG
CCTGTCT(c/-)TCGGGATGGTCAGGGACACACTGTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16217 | TTG CAT GGA GGA AAC TGT GA | Forward | A | |||
| 19251 | CTG CAA CTC CAT CAG AGC AG | Reverse | A | |||
| 19349 | Fluorophore-1 | GAA GAC AGC TAC AGT TCT TAT GGT G | Quencher-1 | WT Probe | ||
| 21045 | Fluorophore-2 | AAG ACA GTT ACA GCA GTT ATC GGT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 16217 | 0.40 uM |
| 19251 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 4.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.