For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 022149
Protocol 22057: End Point Analysis Assay - Tg(CSNK1D*,-EGFP)827Yfu Endpoint
Version 3.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = G/G
Heterozygote = A/G
Wild type = A/A
Sequence
GTACGGACATTGCTGCAGGAGAAGAGGTTGCCATCAAGCTTGAATGTGTCAAA(a/g)CCAAACACCCTCAGCTCCACATTGAGAGCAAAATCTACAAGATGATGCAGGGAGGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 16820 | CAG GAG AAG AGG TTG CCA TC | Forward | A | |||
| 16821 | TTG CTC TCA ATG TGG AGC TG | Reverse | A | |||
| 16823 | Fluorophore-1 | ATG TGT CAA AAC CAA ACA CCC | Quencher-1 | WT Probe | ||
| 16825 | Fluorophore-2 | ATG TGT CAA AGC CAA ACA CCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 16820 | 0.40 uM |
| 16821 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.