Stock No: 020812
Protocol 22017: End Point Analysis Assay - Npr2<pwe> End Point
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 4 nucleotide deletion

Wild type = 4 nucleotides present

Sequence

tgtgtttacccacttttcctatggtggtccttcccctcctgctcaccccgagtcctgtttcca
tggtgcagACTGTATTGGTGATCACATACCGAGAACCCCCAAATCCTGAGTATCAGGAGTTT
CAGAATCGC[ctgc]TGATCAGAGCCCGGGAAGACTTTGGTGTGGAGCTGGCCCCATCCCTGgt
gagtagatctctgagggtcagaacaggctacgaggaagggacttctcacagagtccttgatc
atggagcaagccccatttcaggctgtgacttccatccaggctactaccctttgaccccgggac
cgggggtgggggaggg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
15839 CCC GAG TCC TGT TTC CAT G Forward A
15840 AGC TCC ACA CCA AAG TCT TC Reverse A
15841 Fluorophore-1 AGA ATC GCC TGC TGA TCA GA Quencher-1 WT Probe
15842 Fluorophore-2 TCA GAA TCG CTG ATC AGA GC Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
15839 0.40 uM
15840 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.