For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 020621
Protocol 34280: Probe Assay - Pnpla3<tm1Eek> Probe
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 132 bp
Wild Type = 138 bp
>chr15:83998257+83998394 138bp ACCGGGAGCAGAGCTGAAC CGCTCAGACATAGCGTAGCC
Sequence
Wt Sequence: gtggggcggggcctcagctgacgtcacccgaagacagcttaggcggctgcggctctttaagctcAGAGCAGCAACACCGGGAGCAGAGCTGAACTGCAGCGCCGCCCGGagCTTCAAGcaccATGTATGACCCAGAGCGCCGCTGGAGCCTGTCGTTTGCAGGCTGCGGCTTCCTGGGCTTCTACCACGTCGGGGCTACGCTATGTCTGAGCGAGCGCGCCCCGCACCTCCTCCGCGATGCGCGCACTTTCTTTGGCTGCTCGGCCGGTGCACTGCACGCGGTCACCTTCGTGTGCAGTCTCCCTCTCGgtgcgtccacggccactacc
Mutant Sequence:CTAGTGGGGCGGGGCCTCAGCTGACGTCACCCGAAGACAGCTTAGGCGGCTGCGGCTCTTTAAGCTCAGAGCAGCAACACCGGGAGCAGAGCTGAACTGCAGCGCCGCCCGGAtccggtatcgataagcttgatatcgaattccGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCaggtctgaagaggagtttacgtccagccaagctagcttggctgcaggtcgtcgaaattctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39320 | GCT TGG CTG GAC GTA AAC TC | Mutant Reverse | A | |||
| 43217 | ACC GGG AGC AGA GCT GAA C | Common | A | |||
| 43219 | CGC TCA GAC ATA GCG TAG CC | Wild type Reverse | A | |||
| 43220 | Fluorophore-1 | CCG GAT CCG GTA TCG ATA AGC T | Quencher-1 | MUT Probe | ||
| 43221 | Fluorophore-2 | CCG GAG CTT CAA GCA CCA TGT A | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39320 | 0.40 uM |
| 43217 | 0.40 uM |
| 43219 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.