Stock No: 018958
Protocol 30980: Separated PCR Assay - Cd19<tm1(cre)Cgn> Alternate2
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~200 bp
Heterozygote = ~200 bp and 280 bp
Wild type = 280 bp

>chr7:133557730-133558009 280bp GACTCCTCACCTGTCTCTTCTGA AGAGCTCCTCTTTACCTCCACA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35897 GAC TCC TCA CCT GTC TCT TCT GA Common A, B
35898 AGA GCT CCT CTT TAC CTC CAC A Wild type Reverse A
oIMR8990 CAG GTT CTT GCG AAC CTC AT Mutant Reverse B

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
35897 0.50 uM
35898 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
35897 0.50 uM
oIMR8990 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
006785 B6.129P2(C)-Cd19tm1(cre)Cgn/J
027116 B6.129P2-Cd19tm1(cre/ERT2)Rsky/J
018958 B6N.129P2-Cd19tm1(cre)Cgn/J
004126 C.Cg-Cd19tm1(cre)Cgn Ighb/J
023806 NOD.129P2(Cg)-Cd19tm1(cre)Cgn/J
5 strains use this protocol