Protocol 37158: Probe Assay - Krt8<em1(cre/ERT2)Oan>-Alterante 1
Version 2.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  105 bp

Wild Type = 111 bp

>chr15:101996856-101996966 111bp GAGTCTTCTGATGTCGTGTCCA TCCCTGCACTCTGCCATAC

Sequence

Wt Sequence:GGTTCTGCCGGGGGATCCAACACTTTCAGCCGCACCACCAAGGCTGTGGTTGTGAAGAAGATTGAAACCCGAGATGGGAAGCTGGTGTCCGAGTCTTCTGATGTCGTGTCCAAGtgaATGGCCACTGAAGTCCTTGCCAGCCTGAGCTCCTGCAGCTGCTCAGGGCTCAcGGGGAGACAGCTGTATGGCAGAGTGCAGGGAACTAGAGACCCGTCCGAGGATCAGCCCTAATCCTCTGGCCAACCTTAGGAGGAATTTCCTATCTGGGATATCCCAATGGCTTCTGCCTCCCA

 

Mutant Sequence: GCCCTGGCTTCAGCTACGGAATGAGCTCCTTCCAGCCCGGCTTCGGTTCTGCCGGGGGATCCAACACTTTCAGCCGCACCACCAAGGCTGTGGTTGTGAAGAAGATTGAAACCCGAGATGGGAAGCTGGTGTCCGAGTCTTCTGATGTCGTGTCCAAGggaagcggagctactaacttcagcctgctgaagcaggctggagacgtggaggagaaccctggacCTatggtgcccaagaagaagaggaaagtctccaacctgctgactgtgcaccaaaacctgcctgccctccctgtggatgccacctctgatgaagtcaggaagaacctgatggacatgttcagggacaggcaggccttctctgaacacacctggaagatgctcctgtctgtgtgcagatcctgggctgcctggtgcaagctgaacaacaggaaatggttccctgctgaacctgaggatgtgagggactacctcctgtacctgcaagccagaggcctggctgtgaagaccatccaacagcacctgggccagctcaacatgctgcacaggagatctggcctgcctcgcccttctgactccaatgctgtgtccctggtgatgaggagaatcagaaaggagaatgtggatgctggggagagagccaagcaggccctggcctttgaac

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49368 GAG TCT TCT GAT GTC GTG TCC A Wild type Forward A
49369 TCC CTG CAC TCT GCC ATA C Wild type Reverse A
49372 Fluorophore-1 CTC AGG GCT CAC GGG GAG AC Quencher-1 WT Probe
50732 TTC AGT GGC CAT TCA TTA CTT G Mutant Reverse A
50733 Fluorophore-2 CTC GGC ATG GAC GAG CT Quencher-2
oIMR9102 ACA TGG TCC TGC TGG AGT TC Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
49368 0.40 uM
49369 0.40 uM
50732 0.40 uM
oIMR9102 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.