Stock No: 018272
Protocol 21912: End Point Analysis Assay - Adamts6
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = G/G
Heterozygote = C/G
Wild type = C/C

Sequence

AAACATGATTTTTTAGACAACTGTCACTACACAGGATACTTGCAAGATCAACA

TAGTACAACTAAAGTGGCTTTAAG(C/G)AACTGTGTTGGATTGgtaagtaaatataatt

Ttaaatttctagtgggaaaataaattcacaatgtaaatgtctttcctcagcttaaaataagtagataaataac

atttaagtagaaagataataattttatgttcattgtttctgcttctcttacctttatttttgctattgtaatcttg

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
18560 GAC CCC AGT GGA AAC ATG A Forward A
18561 GCT GAG GAA AGA CAT TTA CAT TGT G Reverse A
18562 Fluorophore-1 GTG GCT TTA AGC AAC TGT GTT GG Quencher-1 WT Probe
18563 Fluorophore-2 GTG GCT TTA AGG AAC TGT GTT GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
18560 0.40 uM
18561 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
018253 C57BL/6J-Adamts6b2b2029Clo/J
018261 C57BL/6J-Adamts6b2b2182Clo/J
022633 C57BL/6J-Adamts6b2b2405Clo/J
022638 C57BL/6J-Adamts6b2b2407Clo/J
018240 C57BL/6J-b2b1879Clo/J
018272 C57BL/6J-b2b2187Clo/J
6 strains use this protocol