Protocol 20765: Probe Assay - Tg(TARDBP*Q331K)-Human Mut-EP
Version 1.0

Notes

This assay cannot distinguish het from hom only the absence or presence of the Q331K human allele

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

TG= 96 bp

IPC= 74 bp

Sequence

ggtggtaatccaggtggctttgggaatcagggtggatttggtaatagcagagggggtggagc
tggtttgggaaacaatcaaggtagtaatatgggtggtgggatgaactttggtgcgttcagca
ttaatccagccatgatggctgccgcccaggcagcacta(c/a)agagcagttggggtatgatgg
gcatgttagccagccagcagaaccagtcaggcccatcgggtaataaccaaaaccaaggcaac
atgcagagggagccaaaccaggccttcggttctggaa

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
29801 GAT GAA CTT TGG TGC GTT CA Mutant Forward A
29802 CTG GCT AAC ATG CCC ATC AT Mutant Reverse A
29804 Fluorophore-1 AGG CAG CAC TAA AGA GCA GTT G Quencher-1 MUT Probe
oIMR1544 CAC GTG GGC TCC AGC ATT Internal Positive Control Forward A
oIMR3580 TCA CCA GTC ATT TCT GCC TTT G Internal Positive Control Reverse A
TmoIMR0105 Fluorophore-2 CCA ATG GTC GGG CAC TGC TCA A Quencher-2 IC Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
29801 0.40 uM
29802 0.40 uM
oIMR1544 0.40 uM
oIMR3580 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
017933 B6.Cg-Tg(Prnp-TARDBP*Q331K)103Dwc/J
017930 B6N.Cg-Tg(Prnp-TARDBP*Q331K)109Dwc/J
2 strains use this protocol