For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 017907
Protocol 20766: Probe Assay - Tg(TARDBP*331)-Human WT-EP
Version 1.0
Notes
This assay cannot distinguish het from hom only the absence or presence of the wt human allele
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Tg= 96 bp
IPC = 74 bp
Sequence
ggtggtaatccaggtggctttgggaatcagggtggatttggtaatagcagagggggtggagc
tggtttgggaaacaatcaaggtagtaatatgggtggtgggatgaactttggtgcgttcagca
ttaatccagccatgatggctgccgcccaggcagcacta(c/a)agagcagttggggtatgatgg
gcatgttagccagccagcagaaccagtcaggcccatcgggtaataaccaaaaccaaggcaac
atgcagagggagccaaaccaggccttcggttctggaa
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 29801 | GAT GAA CTT TGG TGC GTT CA | Mutant Forward | A | |||
| 29802 | CTG GCT AAC ATG CCC ATC AT | Mutant Reverse | A | |||
| 29803 | Fluorophore-1 | AGG CAG CAC TAC AGA GCA GTT G | Quencher-1 | MUT Probe | ||
| oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
| oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
| TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 29801 | 0.40 uM |
| 29802 | 0.40 uM |
| oIMR1544 | 0.40 uM |
| oIMR3580 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.