For in-depth product & services help, ask our
Technical Information Scientists
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Tg Sequence:
ACCCACCTGTCCTACCAGCTGGCTGACCTGTAGCTTTCCCCACCACAGAATCCAAGTCGGAACTCTtggcacctagaggatctcgaCGCCACCATGGTTTCTCATCATCAT
CATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTAC
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
20462 | ACC CAC CTG TCC TAC CAG | Transgene Forward | A | |||
21195 | GTA CAG ATC CCG ACC CAT TTG | Transgene Reverse | A | |||
21196 | Fluorophore-1 | AGC TTT CCC CAC CAC AGA ATC CAA | Quencher-1 | Tg Probe | ||
oIMR1544 | CAC GTG GGC TCC AGC ATT | Internal Positive Control Forward | A | |||
oIMR3580 | TCA CCA GTC ATT TCT GCC TTT G | Internal Positive Control Reverse | A | |||
TmoIMR0105 | Fluorophore-2 | CCA ATG GTC GGG CAC TGC TCA A | Quencher-2 | IC Probe |
Component | Final Concentration |
---|---|
Kapa Probe Fast QPCR | 1.00 X |
ddH2O | |
20462 | 0.40 uM |
21195 | 0.40 uM |
oIMR1544 | 0.40 uM |
oIMR3580 | 0.40 uM |
Wt Probe | 0.15 uM |
Mutant Probe | 0.15 uM |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 95.0 | -- | |
2 | 95.0 | -- | |
3 | 60.0 | -- | |
4 | -- | repeat steps 2-3 for 40 cycles | |
5 | 40.0 | -- | Forever |