For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 017799
Protocol 35640: Standard PCR Assay - Camp<tm1Rlg> Alternate2
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 201 bp
Heterozygote = 201 bp and 221 bp
Wild type = 221 bp
>chr9:109750502-109750722 221bp GCTCTTACTTGGGAGGCAGA AGAGAGTGCTCTGTGCTTCAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24955 | CTT CCT GAC TAG GGG AGG AG | Mutant Reverse | A | |||
| 45705 | GTT TAG GGC TTA TGG CAA ATG A | Mutant Forward | A | |||
| 46588 | GCT CTT ACT TGG GAG GCA GA | Wild type Forward | A | |||
| 46589 | AGA GAG TGC TCT GTG CTT CAG | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 24955 | 0.50 uM |
| 45705 | 0.50 uM |
| 46588 | 0.50 uM |
| 46589 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.