Stock No: 017629
Protocol 32598: Probe Assay - Tirap<tm1Medz> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  127 bp

Wild Type = 132 bp

>chr9:34996667-34996798 132bp AGCCACACAGGATGGTCTCT CTGTCCACGTGTGTTGGTG

Sequence

Wt Sequence:GCTATGCCAGGCACTGAGTCGTAGTCACTGCCGTGTGCTGCTCATCACTCCAGGCTTCCTTCGGGACCCCTGGTGCAAGTACCAGATGCTGCAGGCCCTGACGGAGGCCCCGGCGTCGGAGGGTTGCACCATACCCCTGCTGTCCGGCCTGTCCAGAGCCGCCTATCCGCCGGAACTCCGATTCATGTACTATGTGGATGGCAGAGGCAAGGACGGAGGCTTTTACCAAGTCAAGGAGGCTGTTATACACTgtaagatatagGGGGGCTGAGAAGGGGGACAGGAGGCATCCAGTGTCtagataagaacttTAGGAGGTAGTCTCTGCAGTGCCAGTGAATGGGAAAGCTCCTGGAGAATACTGGCTGGATTTGTACCCTGGCAT

 

Mutant Sequence: aaatgtgtcagtttcatagcctgaagaacgagatcagcagcctctgttccacatacacttcattctcagtattgttttgccaagttctaattccatcagaagctatAACTTCGTATAATGTATGCTATACGAAGTTATctagagtcGACAGGAGGCATCCAGTGTCTAGATAAGAACTTTAGGAGGTAGTCTCTGCAGTGCCAGTGAATGGG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27228 TGC CAA GTT CTA ATT CCA TCA G Mutant Forward A
39504 Fluorophore-1 CTG GCA CTG CAG AGA CTA CCT Quencher-1 Mutant Reverse A
39505 Fluorophore-2 AGC CAC ACA GGA TGG TCT CT Quencher-2 Wild type Forward A
39506 CTG TCC ACG TGT GTT GGT G Wild type Reverse A
39507 Fluorophore-3 CGA CAG GAG GCA TCC AGT GTC Quencher-3 MUT Probe
39508 Fluorophore-4 CAC CCC CGA GTC ACA GTT CAC Quencher-4 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
27228 0.40 uM
39504 0.40 uM
39505 0.40 uM
39506 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.