For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 016975
Protocol 6929: Pyrosequencing Assay - Phactr4<humdy>
Version 1.0
Notes
This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided here.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
GGTGCCTCTGGCCTGTCCTGGCCCCGGGCAGTTGAATCAGCAGGAAGATACCGTA
AGTTTCTGGCTAGCTGAGCTAGTCCTATCTCACAACAGGCCCCTCAGGTAACTCGG
TGTTCAGTGACTAGTAAAGGCAATCTGAATGCATGATTGGCTGTTTCTTGCAGCTC
AGTCAAAGGCCAACTGTGGCTGAACTGCTTGCCAGGAAGATTCTGCGGTTTAATG
AGTATGTGGAAGTAACTGATGCTCATGACTATGACC(g/c)GCGAGCAGACAAACCATG
GACCAAACTGACTCCTGCTGACAAGGTAACTCAAATGTCACACACTCTCTTAGAG
TTTCCCTGTTCCTTGAGATGGAGATAGAATACTTTTTTTATATATATATAAATTTTTAA
GATTTATTTATTATTATATCTAAGTACACTGTAGCTGTCTTCAGATGCACCAGAAGAG
GGCGTCAGATCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGA
ACTTAGGACTTTCAGAA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 12825 | Fluorophore | TGC GGT TTA ATG AGT ATG TGG AA | Forward | |||
| 12826 | TAC CTT GTC AGC AGG AGT CAG TTT | Reverse | ||||
| 12827 | GGT TTG TCT GCT CGC | SEQ |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| KAPA LR HotStart Buf Buffer does not contain MgCl2. | 0.50 |
| MgCl2 | 2.00 |
| dNTP | 0.13 |
| KAPA LR HotStart Taq Initial Denature 3 Min This is a two enzyme system. One with proofreeading the other without. HotStart is provided by antibody. | 0.01 |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | 65.0 | -- | Go to step 2-4, 50 times |
| 6 | 65.0 | -- | |
| 7 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.