Stock No: 016904
Protocol 22112: Probe Assay - Utrn<tm1Ked>-PROBE
Version 4.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

Mutant sequence, including junction:

cgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgc
atcgccttctatcgccttcttgacgagttcttctgaggggatcggcaataaaaagacagaataaaacgcacgggtgttgggtc
gtttgttcggatcATCATGTCAGACCTGCAGCAGACAAACAGCGAGAAGATCCTGCTGAGCTGGG
TGCGGCAGACCACCAGGCCCTACAGTCAAGTCAACGTCCTCAACTTCACCACCAGCTGGACC
GATGGACTCGCGTTCAACGCCGTGCTCCACCGGCACAAGTGAGATGTCTTCCG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
19764 CTT TAC GGT ATC GCC GCT C Mutant Forward A
19765 Fluorophore-1 CGC ATC GCC TTC TAT CGC CTT CT Quencher-1 MUT Probe
19766 AGG ATC TTC TCG CTG TTT GTC Common A
19767 CGT TAT AAG CAG GTG TGG GTC Wild type Forward A
19768 Fluorophore-2 TCT GCA CAG GTG AAG GAT GTC ATG AAA Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
19764 0.40 uM
19766 0.40 uM
19767 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
018802 B10ScSn.129(Cg)-Utrntm1Ked/J
019014 B10ScSn.Cg-Utrntm1Ked Dmdmdx/J
016904 D2.129(B6)-Utrntm1Ked/J
022506 D2.Cg-Utrntm1Ked Dmdmdx/J
014563 STOCK Utrntm1Ked Dmdmdx/J
013158 STOCK Utrntm1Ked/J
6 strains use this protocol