Genotyping Protocols Database
Stock No: 016621
Protocol 35532: Probe Assay - Casp1<tm1Flv> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:5305360+5305506 147bp TGCAGCCAGCTTTATTATTAGAC GGCAAAAGAAAGGGTGACAG

Mutant=  108 bp

Wild Type = 147 bp

Sequence

Wt Sequence: TGCAGCCAGCTTTATTATTAGACTTAACTGTTCCTTTAAATCATTTCCTTTTGTCTTGTACCATATATAGATCTCTAGATCTCCAATTCTAGAGTCTTCTGAACTCTTGCAGTCCACCATCtgAATTCTGTCACCCTTTCTTTTGCC

 

Mutant Sequence: ACTTGTGTAGCGCCAAGTGCCAGCGGGGCTGCTAAAGCGCATGCTCCAGACTGCCTTGGGAAAAGCGCCTCCCCTACCCGGTAgaattctgtcaccctttcttttgcc

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
46312 TGC AGC CAG CTT TAT TAT TAG AC Wild type Forward A
46313 GGC AAA AGA AAG GGT GAC AG Common A
46315 Fluorophore-1 CTA GAG TCT TCT GAA CTC TTG CAG TC Quencher-1 WT Probe
46316 Fluorophore-2 CTG CTA AAG CGC ATG CTC C Quencher-2 MUT Probe
oIMR0950 ACT TGT GTA GCG CCA AGT GC Mutant Forward A

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
46312 0.40 uM
46313 0.40 uM
oIMR0950 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.