Protocol 15085: Pyrosequencing Assay - ** Fbxl21*G149E
Version 3.0

Notes

This assay will NOT distinguish hemizygous from homozygous trangenic animals.  This assay only confirms the point mutation.

This genotyping assay uses pyrosequencing technology and is run on the Biotage PSQ 96MA. The Jackson Laboratory is not posting the complete details of our pyrosequencing genotyping assays as the primers for pyrosequencing cannot be used for sequencing using more traditional methods. The wild type and mutant nucleotides and the flanking DNA sequence are provided below.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = T/T
Wild type has no PCR product for pyrosequencing.
GACCTTGG(g/a)ATTGATTTCA
 
Sequencing primer anneals to the reverse strand.

Sequence

AGATCGAGCCCGGGCTTCGTCCGTGTGCAGGAGATGGAATGAAGTATTCCACATC
CCTGATCTTTGGAGGAAGTTTGAGTTTGAGCTGAACCAATCAGCAACTTCTTATTT
CAAGTCCACTCATCCCGACCTCATTCAACAGATCATCAAAAAGCACGCTGCACAT
CTTCAGTATGTCAGCTTTAAGGTTGATAGCAGTACTGAGTCGGCAGAAGCCGCCT
GTGATATCCTTTCTCAGCTGGTAAATTGTTCTATCCAGACCTTGG(g/a)ATTGATTTCA
ACAGCCAAACCAAGTTTCATGAATGTGCCCAAGTCTCACTTTGTGTCGGCACTTA
CGGTCGTGTTTGTCAACTCAAAATCGTTATCATCGATTAAAATTGAGGACACGCCA
GTGGATGACCCTTCCCTGAAGATTCTTGTGGCTAACAACAGTGACACCCTTCGAC
TCCTCAAAATGAGTAGCTGTCCTCACGTTTCATCTGATGGGATCCTCTGTGTGGCG
GACCACTGTCAGGGCCTCCGAGA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
12535 TGG CTG TTG AAA TCA AT SEQ
12606 Fluorophore AGC CGC CTG TGA TAT CCT T Forward
12607 AGT GCC GAC ACA AAG TGA GAC T Reverse

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.00
MgCl2 2.00
dNTPS-kapa 0.20
12606 0.50
12607 0.50
Glycerol 5.00
Kapa 2G HS taq polym 0.01
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.