Stock No: 016131
Protocol 14520: Pyrosequencing Assay - Sec61a1<m1Gek> PYRO
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Sequence

CATCATCTGGGGGCCCAGCCCGAGCTTACCCCGTTGGTGGCCTGTGTTAC(t/c)ACCTGTCTCCTCCGGAATCGTTCGGCTCAGTGCTGGAGGACCCTGTCCATGCGGTCGTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
12067 TCA GTG GCA ACC TGC TGG TTA G
12069 TTG GTG GCC TGT GTT
12213 Fluorophore CAG CAC TGA GCC GAA CGA T

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.00
MgCl2 2.00
dNTPS-kapa 0.20
12067 0.50
12213 0.50
Glycerol 5.00
Kapa 2G HS taq polym 0.01
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.