For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 014563
Protocol 22112: Probe Assay - Utrn<tm1Ked>-PROBE
Version 4.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
Mutant sequence, including junction:
cgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgc
atcgccttctatcgccttcttgacgagttcttctgaggggatcggcaataaaaagacagaataaaacgcacgggtgttgggtc
gtttgttcggatcATCATGTCAGACCTGCAGCAGACAAACAGCGAGAAGATCCTGCTGAGCTGGG
TGCGGCAGACCACCAGGCCCTACAGTCAAGTCAACGTCCTCAACTTCACCACCAGCTGGACC
GATGGACTCGCGTTCAACGCCGTGCTCCACCGGCACAAGTGAGATGTCTTCCG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 19764 | CTT TAC GGT ATC GCC GCT C | Mutant Forward | A | |||
| 19765 | Fluorophore-1 | CGC ATC GCC TTC TAT CGC CTT CT | Quencher-1 | MUT Probe | ||
| 19766 | AGG ATC TTC TCG CTG TTT GTC | Common | A | |||
| 19767 | CGT TAT AAG CAG GTG TGG GTC | Wild type Forward | A | |||
| 19768 | Fluorophore-2 | TCT GCA CAG GTG AAG GAT GTC ATG AAA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 19764 | 0.40 uM |
| 19766 | 0.40 uM |
| 19767 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.