Protocol 33142: Probe Assay - Gt(Rosa)26Sor(CAG) alternate 2
Version 3.0

Notes

The size of the mutant band can vary between different Gt(Rosa)26sor(CAG) strains.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113025964-113026059 96bp CTTCCCTCGTGATCTGCAAC CAGGACAACGCCCACACA

Mutant=  140 bp

Wild Type = 96 bp

Fam=Mut

Hex=Wt

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
17062 GTT ATG TAA CGC GGA ACT CCA Mutant Reverse A
24500 CAG GAC AAC GCC CAC ACA Wild type Reverse A
36158 CTT CCC TCG TGA TCT GCA AC Common A
39816 Fluorophore-1 ACG GGG TCA TTA GTT CAT AGC CCA Quencher-1 MUT Probe
40263 Fluorophore-2 CCA GTC TTT CTA GAA GAT GGG CGG Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
17062 0.40 uM
24500 0.40 uM
36158 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

Stock Number Strain Name
006053 129-Gt(ROSA)26Sortm1(CAG-EGFP)Luo/J
006067 129-Gt(ROSA)26Sortm2(CAG-Dsred2/EGFP)Luo/J
006041 129-Gt(ROSA)26Sortm3(CAG-EGFP/Dsred2)Luo/J
017626 B6(Cg)-Gt(ROSA)26Sortm1(CAG-GFP/Eif2c2)Zjh/J
007676 B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J
006071 B6.129-Gt(ROSA)26Sortm1(CAG-EGFP)Luo/J
006080 B6.129-Gt(ROSA)26Sortm2(CAG-Dsred2/EGFP)Luo/J
006075 B6.129-Gt(ROSA)26Sortm3(CAG-EGFP/Dsred2)Luo/J
022367 B6.129S4-Gt(ROSA)26Sortm1(CAG-EGFP/Rpl10a,-birA)Wtp/J
026294 B6.Cg-Gt(ROSA)26Sortm2.2Ksvo/J
017455 B6;129-Gt(ROSA)26Sortm1(CAG-COP4*E123T*H134R,-tdTomato)Gfng/J
021429 B6;129-Gt(ROSA)26Sortm4(CAG-EGFP*)Nat/J
021039 B6;129-Gt(ROSA)26Sortm5(CAG-Sun1/sfGFP)Nat/J
026006 B6;129-Gt(ROSA)26Sortm7(CAG-tdTomato*)Nat/J
026005 B6;129-Gt(ROSA)26Sortm9(CAG-GFP*)Nat/J
010523 B6;129P2-Gt(ROSA)26Sortm1(CAG-ALPP)Fawa/J
018385 B6;129S-Gt(ROSA)26Sortm1(CAG-COX8A/Dendra2)Dcc/J
024846 B6;129S-Gt(ROSA)26Sortm2.1Ksvo/J
024750 B6;129S4-Gt(ROSA)26Sortm9(EGFP/Rpl10a)Amc/J
023035 B6;129S6-Gt(ROSA)26Sortm1(CAG-tdTomato*,-EGFP*)Ees/J
026556 B6N.129(B6J)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J
026430 B6N.129(Cg)-Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J
023537 B6N.129S6-Gt(ROSA)26Sortm1(CAG-tdTomato*,-EGFP*)Ees/J
031928 C57BL/6N-Gt(ROSA)26Sortm1(CAG-Il11)Cook/J
026862 D2.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/SjJ
026481 FVB.129(B6)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J
026558 FVB.129(B6)-Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J
026431 NOD.129(B6)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J
026557 NOD.129(Cg)-Gt(ROSA)26Sortm1.1(CAG-cas9*,-EGFP)Fezh/J
010675 STOCK Gt(ROSA)26Sortm1(CAG-EGFP)Fsh/Mmjax
010701 STOCK Gt(ROSA)26Sortm1.1(CAG-EGFP)Fsh/Mmjax
022386 STOCK Gt(ROSA)26Sortm1.1(CAG-EGFP/Rpl10a,-birA)Wtp/J
010812 STOCK Gt(ROSA)26Sortm1.2(CAG-EGFP)Fsh/Mmjax
018906 STOCK Gt(ROSA)26Sortm3(CAG-flpo/ERT2)Alj/J
007576 STOCK Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J
024107 STOCK Gt(ROSA)26Sortm5(ACTB-tTA)Luo Igs7tm93.1(tetO-GCaMP6f)Hze/HzeJ
024112 STOCK Gt(ROSA)26Sortm5(ACTB-tTA)Luo Igs7tm94.1(tetO-GCaMP6s)Hze/J
014552 STOCK Nkx2-1tm1.1(cre/ERT2)Zjh/J
38 strains use this protocol