For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 014535
Protocol 18709: End Point Analysis Assay - Kif18a<R308K>-EP
Version 1.0
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant =A
Wild type = G
Sequence
GAGAAGAAATCAGCATATTCCTTACA(g/a)AAATAGTAAGCTTACTCGTTTGCTGAAGG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 27514 | CTT TCA GAG AAG AAA TCA GCA T | Forward | A | |||
| 27515 | GTT TGA CAG TTT CCT CCA AGA G | Reverse | A | |||
| 27516 | Fluorophore-1 | CAT ATT CCT TAC AGA AAT AGT AAG CTT | Quencher-1 | WT Probe | ||
| 27517 | Fluorophore-2 | CAT ATT CCT TAC AAA AAT AGT AAG CTT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 27514 | 0.40 uM |
| 27515 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.