For in-depth product & services help, ask our
Technical Information Scientists
An additional primer was provided by the Donating Investigator for this strain.
CTGTGCTGCCTAATCTGTCG: deleted allele is around 300bp
Please note, this primer is to be used in conjuction with the two primers listed below in order to detect the null allele. This third primer has NOT been validated by the Transgenic Genotyping Service at The Jackson Laboratory.
Mutant = 450 bp
Heterozygote = 450 bp and 348 bp
Wild type = 348 bp
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
11532 | ATC GGA ATG TGA TCC AGC TT | Forward | A | |||
11533 | ACG TAG GCT GTG CAA CCT CT | Reverse | A |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
11532 | 0.50 uM |
11533 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |