For in-depth product & services help, ask our
Technical Information Scientists
An additional primer was provided by the Donating Investigator for this strain.
acacccgagaggaaacacac: deleted allele is around 300bp
Please note, this primer is to be used in conjuction with the two primers listed below in order to detect the null allele. This third primer has NOT been validated by the Transgenic Genotyping Service at The Jackson Laboratory.
Sequence data provided by the Donating Investigator:
Mutant = 450 bp
Heterozygote = 341 bp and 450 bp
Wild type = 341 bp
Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
---|---|---|---|---|---|---|
11530 | GCA GGC GAA TTT CTG AGT TC | Forward | A | |||
11531 | TCC CCT TGA ACA AGC ATA CC | Reverse | A |
Component | Final Concentration |
---|---|
ddH2O | |
Kapa 2G HS buffer | 1.30 X |
MgCl2 | 2.60 mM |
dNTPS-kapa | 0.26 mM |
11530 | 0.50 uM |
11531 | 0.50 uM |
Glycerol | 6.50 % |
Dye | 1.00 X |
Kapa 2G HS taq polym | 0.03 U/ul |
DNA |
Step | Temp °C | Time | Note |
---|---|---|---|
1 | 94.0 | -- | |
2 | 94.0 | -- | |
3 | 65.0 | -- | -0.5 C per cycle decrease |
4 | 68.0 | -- | |
5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
6 | 94.0 | -- | |
7 | 60.0 | -- | |
8 | 72.0 | -- | |
9 | -- | repeat steps 6-8 for 28 cycles | |
10 | 72.0 | -- | |
11 | 10.0 | -- | hold |