Stock No: 014142
Protocol 29001: Standard PCR Assay - Prkaa2<tm1Sjm>
Version 2.2

Notes

An additional primer was provided by the Donating Investigator for this strain.

acacccgagaggaaacacac: deleted allele is around 300bp

Please note, this primer is to be used in conjuction with the two primers listed below in order to detect the null allele.  This third primer has NOT been validated by the Transgenic Genotyping Service at The Jackson Laboratory.

Sequence data provided by the Donating Investigator:

The loxPs are inserted as below;
tattctgtaatagatagtgatgttaaatagaagatgaaaaataaggaaa<5’ loxP>atataatgaattctattctgtctaaaagattattctgtctaaaagatgttccatagtattctaatgaagga
 
attcatattttgttttaatgttagttcattcccctctgtcatttctt<3’loxP>cagtgtacattcttggcttaaaactaaagccttgcttcagagtcagcactaggcaggtggtgagtgcagcctt

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 450 bp
Heterozygote = 341 bp and 450 bp
Wild type = 341 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
11530 GCA GGC GAA TTT CTG AGT TC Forward A
11531 TCC CCT TGA ACA AGC ATA CC Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
11530 0.50 uM
11531 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.