Protocol 30765: Probe Assay - Braf<tm1Mmcm> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  84 bp

Wild Type = 132 bp

>chr6:39578176-39578307 132bp ACTGGCTTAGTAGTAGATGAGATTTGA CCAGGCTCTTTATGAGAATACAGT

Sequence

Wt Sequence: gagtatttttgtggcaactgctttagctcatctaactggcttagtagtagatgagatttgaaacctaagaaaattatttaacagacatgaagaaacgatttttctttttgtgtctcAGTCCACGgagctcctttctgacatcactgtattctcataaagagcctgggccgctttcccagcagagttaaagtgt

Mutant Sequence: CAACTGCTTTAGCTCATCTAACTGGCTTAGTAGTAGATGAGATTTGAAACCTAAGAAAATTATTTAACAGACATGAAGAAACGATTTTTCTTTTTGTGTCTCgaatcaacaagtttgtacaaaaaagcaggctccgaattcgagataacttcgtataatgtatgctatacgaagttattctagatgacctgcgagggacgctgtaattgacgacgcaaataaagagaggacctGAGCTCCTTTCTGACATCACTGTATTCTCATAAAGAGCCTGGGC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
35428 CGA GGG ACG CTG TAA TTG A Mutant Forward A
35431 CCA GGC TCT TTA TGA GAA TAC AGT Common A
35432 ACT GGC TTA GTA GTA GAT GAG ATT TGA Wild type Forward A
35433 Fluorophore-1 CGA CGC AAA TAA AGA GAG GAC CT Quencher-1 MUT Probe
35434 Fluorophore-2 TGT GTC TCA GTC CAC GGA GCT C Quencher-2 WT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
35428 0.40 uM
35431 0.40 uM
35432 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.