Stock No: 013175
Protocol 39846: Probe Assay - Grn<tm1.1Aidi> Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:102432318+102432411 94bp GGAAGGGCTCACCATGAAGT ACCGCCTACCCACAACTGTC

Mutant=  110 bp

Wild Type = 94 bp

Sequence

Wt Sequence:

gggaagggctcaccatgaagttagctttaaggctgatccagtcTCTGTGTCCCCTTCCCTTGGgtggggtggggggacagttgtgggtaggcgg

Mutant Sequence:

agagggtgagctgcaatgttgctgagtctggtttccaactcctggggttcataacttcgtataatgtatgctatacGAAGTTATtaggtggatccacTAagaaggtgacagataaggatgccgaattaggggtctggggacacggagaggccatgctggagtggtttaacaccactggatgccttagttgtctctctgcagta

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
54745 GGA AGG GCT CAC CAT GAA GT Wild type Forward A
54746 ACC GCC TAC CCA CAA CTG TC Wild type Reverse A
54747 AGC TGC AAT GTT GCT GAG T Mutant Forward A
54748 TCC TTA TCT GTC ACC TTC TTA GTG G Mutant Reverse A
54749 Fluorophore-1 TCT GTG TCC CCT TCC CTT GG Quencher-1 WT Probe
54750 Fluorophore-2 CTG GTT TCC AAC TCC TGG GG Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
54745 0.40 uM
54746 0.40 uM
54747 0.40 uM
54748 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 40.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.