Protocol 35516: Probe Assay - Tg(Thy1-TARDBP)4Singh-Chr6-Probe
Version 1.0

Notes

Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.

 

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant=  95 bp

Wild Type = 81 bp

>chr6:56525032+56525112 81bp TCCCAGCTTGTGGCTCTCTA AGGCTGCAGTCAGAGGTGAGT

Sequence

Wt Sequence:
tgaatctcaaatatcctctacaggcttctgttttgtgttttaaacaattggttcccagcttgtggctctctaactggctTCactggttccaagaggagcccttgaaggttaaactcacctctgactgcagcctgatttcccttcttctggacttgtcctgatgaaactcagccacaagcctgctaccttggtgaattgaaatgcctcaaaaact
 
Mutant Sequence:
TGATTTCTTTTTTGATGTATTGTTTTGGCTTGAATCTCAAATATCCTCTACAGGCTTCTGTTTTGTGTTTTAAACAATTGGTTCCCAGCTTGTGGCTCTCTAACTGGCTtgTTGTACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAA

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
27301 TTC AGG TTC AGG GGG AGG T Mutant Reverse A
46271 TCC CAG CTT GTG GCT CTC TA Common A
46272 AGG CTG CAG TCA GAG GTG AGT Wild type Reverse A
46273 Fluorophore-1 ACT GGT TCC AAG AGG AGC C Quencher-1 WT Probe
46274 Fluorophore-2 TGT ACC ACA TTT GTA GAG GTT TTA CTT G Quencher-2 MUT Probe

Reaction A

Component Final Concentration
Kapa Probe Fast QPCR 1.00 X
ddH2O
27301 0.40 uM
46271 0.40 uM
46272 0.40 uM
Wt Probe 0.15 uM
Mutant Probe 0.15 uM
DNA

Cycling

Step Temp °C Time Note
1 95.0 --
2 95.0 --
3 60.0 --
4 -- repeat steps 2-3 for 40 cycles
5 4.0 -- Forever
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.